Last updated on 2024-10-16 05:48:40 CEST.
Flavor | Version | Tinstall | Tcheck | Ttotal | Status | Flags |
---|---|---|---|---|---|---|
r-devel-linux-x86_64-debian-clang | 1.0.3 | 33.54 | 41.18 | 74.72 | OK | |
r-devel-linux-x86_64-debian-gcc | 1.0.3 | 25.25 | 30.37 | 55.62 | OK | |
r-devel-linux-x86_64-fedora-clang | 1.0.3 | 141.83 | OK | |||
r-devel-linux-x86_64-fedora-gcc | 1.0.3 | 144.89 | OK | |||
r-devel-windows-x86_64 | 1.0.3 | 40.00 | 0.00 | 40.00 | FAIL | |
r-patched-linux-x86_64 | 1.0.3 | 35.62 | 38.75 | 74.37 | OK | |
r-release-linux-x86_64 | 1.0.3 | 34.80 | 38.80 | 73.60 | OK | |
r-release-macos-arm64 | 1.0.3 | 38.00 | OK | |||
r-release-macos-x86_64 | 1.0.3 | 45.00 | OK | |||
r-release-windows-x86_64 | 1.0.3 | 39.00 | 0.00 | 39.00 | FAIL | |
r-oldrel-macos-arm64 | 1.0.3 | 43.00 | NOTE | |||
r-oldrel-macos-x86_64 | 1.0.3 | 70.00 | NOTE | |||
r-oldrel-windows-x86_64 | 1.0.3 | 43.00 | 0.00 | 43.00 | FAIL |
Version: 1.0.3
Check: C++ specification
Result: NOTE
Specified C++11: please drop specification unless essential
Flavors: r-devel-windows-x86_64, r-release-windows-x86_64, r-oldrel-windows-x86_64
Version: 1.0.3
Check: examples
Result: FAIL
Check process probably crashed or hung up for 20 minutes ... killed
Most likely this happened in the example checks (?),
if not, ignore the following last lines of example output:
> infile <- system.file("extdata", "hmp50.bz2", package = "rbiom")
> biom <- read.biom(infile)
>
> sample.names(biom)
[1] "HMP01" "HMP02" "HMP03" "HMP04" "HMP05" "HMP06" "HMP07" "HMP08" "HMP09"
[10] "HMP10" "HMP11" "HMP12" "HMP13" "HMP14" "HMP15" "HMP16" "HMP17" "HMP18"
[19] "HMP19" "HMP20" "HMP21" "HMP22" "HMP23" "HMP24" "HMP25" "HMP26" "HMP27"
[28] "HMP28" "HMP29" "HMP30" "HMP31" "HMP32" "HMP33" "HMP34" "HMP35" "HMP36"
[37] "HMP37" "HMP38" "HMP39" "HMP40" "HMP41" "HMP42" "HMP43" "HMP44" "HMP45"
[46] "HMP46" "HMP47" "HMP48" "HMP49" "HMP50"
>
>
>
>
> cleanEx()
> nameEx("select")
> ### * select
>
> flush(stderr()); flush(stdout())
>
> ### Name: select
> ### Title: Reduce samples to a specific list
> ### Aliases: select
>
> ### ** Examples
>
> library(rbiom)
>
> infile <- system.file("extdata", "hmp50.bz2", package = "rbiom")
> biom <- read.biom(infile)
======== End of example output (where/before crash/hang up occured ?) ========
Flavor: r-devel-windows-x86_64
Version: 1.0.3
Check: examples
Result: FAIL
Check process probably crashed or hung up for 20 minutes ... killed
Most likely this happened in the example checks (?),
if not, ignore the following last lines of example output:
>
> ### ** Examples
>
> library(rbiom)
>
> infile <- system.file("extdata", "hmp50.bz2", package = "rbiom")
> biom <- read.biom(infile)
>
> taxa.names(biom) %>% head()
[1] "UncO2713" "UncO4101" "AnmMass2" "PreBivi6" "CprSpeci" "Unc96922"
>
>
>
>
> cleanEx()
> nameEx("taxa.ranks")
> ### * taxa.ranks
>
> flush(stderr()); flush(stdout())
>
> ### Name: taxa.ranks
> ### Title: Get the taxa ranks.
> ### Aliases: taxa.ranks
>
> ### ** Examples
>
> library(rbiom)
>
> infile <- system.file("extdata", "hmp50.bz2", package = "rbiom")
> biom <- read.biom(infile)
======== End of example output (where/before crash/hang up occured ?) ========
Flavor: r-release-windows-x86_64
Version: 1.0.3
Check: package dependencies
Result: NOTE
Package suggested but not available for checking: ‘rhdf5’
Flavors: r-oldrel-macos-arm64, r-oldrel-macos-x86_64
Version: 1.0.3
Check: examples
Result: FAIL
Check process probably crashed or hung up for 20 minutes ... killed
Most likely this happened in the example checks (?),
if not, ignore the following last lines of example output:
"TGAGGAATATTGGTCAATGGACGCAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATATGGGGATAAAGTGGGGAACGTGTTCCCTTTTGCAGGTACCATATGAATAAGGACCGGCTAATTCCGTGCCAGCAGCCGCGGTAATACGGAAGGTTCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGGTAAGCGTGTTGTGAAATGTAGGAGCTCAACTTCTAGATTGCAGCGCGAACTGTCAGACTTGAGTGCGCACAACGTAGGCGGAATTCATGGTGTAGCGGTGAAATGCTTAGATATCATGAAGAACTCCGATTGCGAAGGCAGCTTACGGGAGCGCAACTGACGCTGAAGCTCGAAGGTGCGGGTATCGAACAGGATTAGATACCCTGGTAGTCCGCACAGTAAACGATGGATGCCCGCTGTTAGCACCTAGTGTTAGCGGCTAAGCGAAAGCATTAAGCATCCCACCTGGGGAGTACGCCGGCAACGGTGAA"
>
> # Write to a compressed fasta file in the temporary directory:
> seqs <- sequences(biom)
> conn <- bzfile(file.path(tempdir(), "Sequences.fa.bz2"), "w")
> cat(sprintf(">%s\n%s", names(seqs), seqs), file=conn, sep="\n")
> close(conn)
>
> # You can also use the write.fasta function for this task:
> write.fasta(biom, file.path(tempdir(), "Sequences.fa.gz"))
>
>
>
>
> cleanEx()
> nameEx("subset")
> ### * subset
>
> flush(stderr()); flush(stdout())
>
> ### Name: subset
> ### Title: Subset samples using the BIOM object's metadata
> ### Aliases: subset subset.BIOM
>
> ### ** Examples
>
> library(rbiom)
>
> infile <- system.file("extdata", "hmp50.bz2", package = "rbiom")
> biom <- read.biom(infile)
======== End of example output (where/before crash/hang up occured ?) ========
Flavor: r-oldrel-windows-x86_64